BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 3MCQ
Summary Introduction
Introduction:
mRNA is formed by copying the DNA sequence, and the process is known as transcription. This process occurs in three steps which are initiation, elongation, and termination. After these steps, the complementary RNA molecule is formed.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the correct tRNA anti-codon sequence for the AUG mRNA sequences?
a. UGA
b. UAC
c. CAU
d. AUG
Use the pre-mRNA sequence shown below to answer
the following questions.
MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
a. Underline the 5' and 3' splice sites, then write the
sequence of the spliced mRNA in the space provided.
b. Predict what would happen if the G in the 5' splice
site were mutated to a C.
c. We learned in this topic that the 5' cap in an mRNA
plays a role in translation initiation. What do you think
is one plausible mechanism by which a 5' cap can
enhance initiation ? How can you experimentally
demonstrate that a 5' cap is important for this process
?
Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′
Chapter 7 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 7.1 - Prob. 1MCCh. 7.1 - Prob. 2MCCh. 7.2 - Prob. 1MCCh. 7.2 - Prob. 2MCCh. 7.2 - Prob. 3MCCh. 7.3 - Prob. 1MCCh. 7.3 - Prob. 2MCCh. 7.3 - Prob. 3MCCh. 7.3 - Prob. 4MCCh. 7.3 - Prob. 5MC
Ch. 7.4 - Prob. 1MCCh. 7.4 - Prob. 2MCCh. 7.4 - Prob. 3MCCh. 7.5 - Prob. 1MCCh. 7.5 - Prob. 2MCCh. 7.5 - Prob. 3MCCh. 7.5 - Prob. 4MCCh. 7.5 - Prob. 5MCCh. 7.6 - Prob. 1MCCh. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.7 - Prob. 1MCCh. 7.7 - Prob. 2MCCh. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.8 - Prob. 1MCCh. 7.8 - Prob. 2MCCh. 7.8 - Prob. 3MCCh. 7.8 - Prob. 4MCCh. 7.8 - Prob. 5MCCh. 7.9 - Prob. 1MCCh. 7.9 - Prob. 2MCCh. 7.10 - Prob. 1MCCh. 7.10 - Prob. 2MCCh. 7 - If one strand of DNA has the sequence ATTGTCC,...Ch. 7 - Transcription copies a _____ to a complementary...Ch. 7 - Prob. 3MCQCh. 7 - Prob. 4MCQCh. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - At which stage in viral replication does the...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 1WIOCh. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Prob. 5WIOCh. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - How many codons are in the mRNA molecule that you...Ch. 7 - Prob. 10WIOCh. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Prob. 13WIOCh. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - Prob. 16WIOCh. 7 - Prob. 17WIOCh. 7 - Prob. 18WIOCh. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - Prob. 1SLCh. 7 - Prob. 1PITCh. 7 - Where do promoters, terminators, stop codons,...Ch. 7 - Prob. 3PITCh. 7 - Review the Survey the Landscape figure in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Choose the combination of answers that most accurately completes the statement. Which of these features is found in eukaryotes but not bacteria? a. polygene mRNAs c. stop codon b. intronsarrow_forwardWhat type of mutation caused Nicholas’s disease?a. frameshift b. missense c. nonsense d. insertionarrow_forwardWhich pre-mRNA processing step is important for initiating translation? a. poly-A tail b. RNA editing c. splicing d. 7-methylguanosine caparrow_forward
- Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardWhich molecule contains the genetic code? A. rDNA B. rRNA C.Ribosome D. mRNA E. tRNAarrow_forwardA given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers providedarrow_forward
- A retrotransposon does NOT contain genes for which polyprotein? a. gag b. pol c. It contains genes for all of these polyproteins d. envarrow_forwardWhich library would you screen if the goal was to identify the coding sequence for a protein? a. genomic library b. RNA library c. protein domain library d. cDNA libraryarrow_forwardCompare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the result of aarrow_forward
- Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertionarrow_forwardWhat transcripts will be most affected by low levels of α- amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAsarrow_forwardRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is cancer? What causes cancer and how is it treated? *UPDATE*; Author: Cancer Treatment Centers of America - CTCA;https://www.youtube.com/watch?v=_N1Sk3aiSCE;License: Standard Youtube License