Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8.2, Problem 3NP
Summary Introduction
Introduction:
The
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Synthesize a Protein
5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.
DNA
MRNA
G
C
C
G
T
A
6. What is the name of the enzyme which catalyzes this reaction?
7. What three things must then happen to the pre-MRNA you just synthesized before it is allowed to exit
the nucleus?
8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time to
transcribe the mRNA. You may use the abbreviations for the amino acids found in Figure 15.8 of your
textbook
DNA
C
A
G
C
A
C
C
T.
G
A
G
C
C
A
MRNA
Peptide
chain
1. A certain mRNA codon is determined to be AUG.
a. What is the tRNA anticodon?
b. What is the DNA sequence responsible for the mRNA codon?
c. What is the amino acid coded?
F. RNA TRANSCRIPTION AND GENE EXPRESSION
1. The template strand of a segment of double-helical DNA contains the sequence
(5) СТТААСАССССТGAСТТСGCGCCGTCG (3')
What is the base sequence of the mRNA that can be transcribed from this strand?
b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5' end?
а.
Chapter 8 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 8.1 - Define the terms genome and gene.Ch. 8.1 - Differentiate between genotype and phenotype.Ch. 8.1 - Draw a segment of DNA, labeling all important...Ch. 8.1 - Summarize the steps of bacterial DNA replication,...Ch. 8.1 - Compare and contrast the synthesis of leading and...Ch. 8.1 - Prob. 1NPCh. 8.2 - Provide an overview of the relationship among DNA,...Ch. 8.2 - Identify important structural and functional...Ch. 8.2 - Draw a picture of the process of transcription.Ch. 8.2 - List the three types of RNA directly involved in...
Ch. 8.2 - Prob. 10AYPCh. 8.2 - Identify the locations of the promoter, the start...Ch. 8.2 - Indicate how eukaryotic transcription and...Ch. 8.2 - NCLEX PREP 2. The following are all true of RNA,...Ch. 8.2 - Prob. 3NPCh. 8.3 - Define the term operon, and explain one advantage...Ch. 8.3 - Prob. 14AYPCh. 8.4 - Prob. 15AYPCh. 8.4 - Prob. 16AYPCh. 8.5 - Prob. 17AYPCh. 8.5 - Differentiate among frameshift, nonsense, silent,...Ch. 8.5 - Prob. 19AYPCh. 8.5 - Prob. 1MMCh. 8.6 - Explain the importance of restriction...Ch. 8.6 - List the steps in the polymerase chain reaction.Ch. 8.6 - Describe how you can clone a gene into a...Ch. 8.6 - Prob. 23AYPCh. 8.6 - Prob. 24AYPCh. 8.6 - Name two genetic techniques that are designed to...Ch. 8.6 - NCLEX PREF 4. A client is being treated with...Ch. 8.6 - Prob. 2MMCh. 8 - Single nucleotide polymorphisms are found in a....Ch. 8 - Using your knowledge of DNA from this chapter,...Ch. 8 - Conduct research on CRISPR and explain in...Ch. 8 - Which of the following is a characteristic of RNA?...Ch. 8 - List some advantages and disadvantages to a cell...Ch. 8 - Construct an argument for why tRNA contains a lot...Ch. 8 - Prob. 7QCh. 8 - Discuss the intersection between the metabolome...Ch. 8 - Defend this statement: All of biology is dependent...Ch. 8 - DNA is semiconservative because the ______ strand...Ch. 8 - Examine the DNA triplets here and determine the...Ch. 8 - Prob. 12QCh. 8 - Prob. 13QCh. 8 - Prob. 14QCh. 8 - Metagenomics is providing insight into the...Ch. 8 - The creation of biological molecules and cells...Ch. 8 - Prob. 17QCh. 8 - Genetically modified organisms (GMOs)especially in...Ch. 8 - Prob. 19QCh. 8 - Construct an analogy using your clothes closet to...Ch. 8 - Prob. 21QCh. 8 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardemist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at a ribosome is: a. GUA b. UAG c. UGA d. AUG GC AT e. b and c CUAT 20. Which of the following terms is defined as the process by which water breaks down (splits apart) polymers intoarrow_forwardQ4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs. B. The length of the polyA tail. C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.arrow_forward
- put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2. Binding of large ribosomal subunit to mRNA 3. Binding of small ribosomal subunit to mRNA 4. Binding of tRNA with 2nd amino acid to the A site 5. Formation of covalent bond between methionine and second amino acid A) 1, 2, 3, 4, 5 B) 3, 1, 2, 4, 5 C) 1, 3, 2, 4, 5 D) 2, 3, 1, 4, 5 E) 3, 2, 1, 4, 5arrow_forwardTranscription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?arrow_forwardWhich of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.arrow_forward
- 3a. Select all the correct types of RNA that are both the product of transcription and are also translated in the cytoplasm. ☐ snRNAs ☐ pre-tRNAs ☐ rRNA ☐ tRNA ☐ miRNA ☐ mRNA 3b. The ribozyme found in the ribosome catalyzes ... (which of the following?) a. the synthesis of pre-mRNA as part of the transcription process. b. the formation of the peptide bond. c. the association between the large and small ribosomal subunits. d. a reaction that uses RNA as a substrate.arrow_forward1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right since that’s the template strand you will need in the next question to transcribe the mRNA. 2. Transcribe the DNA sequence above and separate the triplets into codons. Indicate 5’ and 3’ in the correct location on the strand. (Don’t worry about splicing- assume that the pre- mRNA is the same as the mature mRNA sequence) 3. Look at the genetic code, and indicate which amino acid is coded for by the codons in the above mRNA. 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution was by either circling it or writing it in a different color. Then write the mutated DNA sequence with the point mutation (aka substitution) wherever you choose for it to be. Again, circle it or write it in a different color. Do the same for the transcribed mRNA. Repeat the directions for 2 and 3 for this new DNA stand. (i.e., include the mRNA and translated protein…arrow_forward7. Accuracy in the translation of mRNA into the primary structure of a polypeptide, depends on specificity in the_. (LS1-1) * binding of the anticodon to the codon and the attachment of amino acids to tRNAs. binding of the anticodon to small subunit of the ribosome. attachment of amino acids to rRNAs. binding of ribosomes to mRNA.arrow_forward
- 5. A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the corresponding MRNA. • Determine the amino acid sequence formed from the MRNA during translation. What amino acid sequence results from each of the following mutations? replacement of the underlined guanine by adenine insertion of thymine immediately after the underlined guanine deletion of the underlined guanine a. b. C.arrow_forwardPart II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during the process of transcription to do following: • Label the 3' and 5' ends of all polynucleotides appropriately • Label the mRNA transcript • Label the template strand HillT لليليلا UFUP 5. What protein is responsible for making the "bubble" in the DNA shown above?arrow_forward1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license