Name the primary sources of ATP for: a. Immediate energy for a few seconds b. Energy extending to about 15 seconds c. Energy for up to 1 minute. d. Energy extending for around an hour of exercise and beyond.
Q: The patient has mechanical jaundice. Will it affect the absorption of fat-soluble vitamins? There…
A: To live a healthy and active life, humans need a variety of nutrients. Good nutrition, or the…
Q: The following is a(n) [Select] [Select] V [Select] disaccharide with a(n) glycosidic bond.
A: Disaccharides are sugars which are formed as a glycosidic bond is formed between 2 monosaccharides.…
Q: Biochemistry Plz answer these 2 question 1. How to differentiate between beta-amylase from alpha…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: How does the degree of unsaturation and structure of fats affect its functionality, for example in…
A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…
Q: RESULTS Table 1. Absorbance values of BSA standards. ● ● Test Tube No. BSA (μL) DDW (μL) 100 80 60…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Enzymes as biological catalysts of metabolic reactions. Properties of enzymes as protein substances.
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate using the enzyme…
A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…
Q: 4. Compare regulation by allosteric control, reversible covalent modification, and proteolytic…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose…
A: Phosphoglucomutase is the enzyme that catalyze the interconversion between glucose 1-phosphate (G1P)…
Q: The primary purpose of the aconitase step in Citric Acid Cycle is to: form the intermediate…
A: The citric acid cycle involves acetyl-CoA oxidation into carbon dioxide and water. The acetyl-CoA…
Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: DNA is the genetic material in most organisms. During transcription RNA Polymerase synthesizes the…
Q: You want to study a biomolecule in the laboratory. You have ordered the synthetic gene from a…
A: The process by which a specific gene sequence of interest is ligated and then the newly synthesized…
Q: Discuss three of the major steroids derived from cholesterol and their physiological role.
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…
A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: How are GMOs applications of biotechnology?
A: Introduction:- The question is all about the genetic technology where genetic modification takes…
Q: Describe the four levels of protein in great depth. Desrcibe how protein structure may affect…
A: Proteins are biomolecules composed of amino acids. Amino acids are joined together through peptide…
Q: A pentapeptide has the abbreviation "GREAT". Draw the peptide and give its systematic name.
A: Peptides are short sequences of amino acids. Amino acids in a peptide are joined together through…
Q: 1. Draw (or insert) the general formula of an amino acid and label the four components. Which one…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question for…
Q: Both myoglobin and hemoglobin can adopt both T and R states. Both myoglobin and hemoglobin bind to…
A: Hemoglobin and Myoglobin: In terms of primary sequence, myoglobin and hemoglobin are only distantly…
Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…
A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…
Q: Identify whether the base sequences represent only a DNA sequence, only an RNA sequence, or either a…
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Prepare 1.5L 2X Base stock in a media bottle: Fill out the last column of this table: Component…
A: A buffer is a solution that can resist pH change upon the addition of acids or bases. Buffers…
Q: Which of the following molecular formulas would be for an aldopentose? C4H8O4 C₂H₁408 C6H12O6…
A:
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Q: I. Enzyme activity can be regulated by allosteric enzymes, feedback control, and covalent…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: calculate the [PNP] in μM for each of these samples. For Table 2: Calculate the volumes of the 100…
A: 0.5mM =0.5 ×10-3 moles literi.e. 1 liter have 0.5 ×10-3 molesSo, 106 μL have 0.5 ×10-3 molesSo, 1…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: A total of 7.21 g of dry mixture with a protein content of 89.2% (w/w) determined by Kjeldahl…
A: % w/w tells us the grams of analyte in 100g of mixture. Hence, a protein content of 89.2% (w/w)…
Q: How do Lipids vary from other macromolecules?
A: A living cell is the basic unit of life. It is capable of independent existence (as is the case of…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introducion Transcription is a process by which mRNA is produced from DNA and protein is produced…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Introduction Amino acids are the building blocks of protein. Two amino acids are joined by peptide…
Q: 3 Consider the reaction shown below and answer the questions that follow. HO-P-O-CH он HN DH H X…
A: DNA (deoxyribonucleic acid) is a type of nucleic acid which is composed of deoxyribonucleotides.…
Q: When studying the mechanism of the enzymatic reaction, functional groups were found that ensure the…
A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: 4. In the space below provide a mechanism for this reaction that proceeds through the intermediate…
A: Glycolysis is the process by which one molecule of 6-carbon glucose is broken down into 2 molecules…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: Calculate protein concentration in unknown samples 1, 2, 3: Absorbance of Unknown 1 = 0.541…
A: Given that the standard BSA concentration is 1mg/mL. 10, 20, 30 ,40 and 50 µL of the standard BSA…
Q: Phosphorylases and phosphatases catalyze the same reaction, the removal of a phosphate group. True…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions by decreasing…
Q: Report Table PP.7: Ninhydrin test Analysis of results for the Ninhydrin tests Glycine Tyrosine…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 4. Which of the following mutations would most likely keep the transitions of T state to R state in…
A: Amino acids are biomolecules that have a carboxyl group, an amino group and a side group linked to…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: fatty acid designated as 20:0 is ________, while one that is designated 20:3 D5,8,11 is ________.…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: 2. Enzyme-catalyzed reactions. Answer the following with true or false. If false, explain why. (a)…
A: Enzyme is a biological catalyst, protein in nature which can increase the chemical reaction without…
Name the primary sources of ATP for:
a. Immediate energy for a few seconds
b. Energy extending to about 15 seconds
c. Energy for up to 1 minute.
d. Energy extending for around an hour of exercise and beyond.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
can you explain this again in a different way? im confused i believe theres more information missing
- Which of the following is a valid statement about lactate? a. Is responsible for the burning sensation in the muscles during exercise b. Primarily produced as a result of insufficient oxygen availability in the cell c. Causes DOMS after rigorous exercise d. “Metabolic waste product” produced during exercise e. Ice massage should be employed after exercise to flush lactate out of the skeletal muscle after exercise f. None of the above are true g. Both A and B are trueList and describe the 3 pathways for ATP regeneration. Be sure to include the source, how much ATP is produced per pathway, and their relevance to activity/exercise.Which of the following conditions is not applicable to measuring basal metabolic rate? a. reclining b. the time immediately after a meal c. room temperature d. resting
- 7B. Explain how muscles obtain energy for contraction (esp. in absence of O2). Be sure to discuss the 4 major methods muscles use to obtain energy during short, intense exercise.Describe how each of the following levels of organization contribute to homeostasis of cellular ATP levels during exercise. 1. Cellular:2. Organ (in this case a whole muscle):3. Organ Systems:Age and excessive adipose tissue are: A. Intrinsic factors of algor mortis B. Intrinsic factors of agonal edema C. Hypostasis factors D. Cardinal signs of decomposition
- Substrates Carbohydrate serves as fuel for ATP production a. during short-duration, high-intensity exercise b. after many hours of low-intensity exercise c. during periods of starvation d. during severe caloric restriction O0000In which of the following types of exercise would creatine phosphate (CP) be an important source of energy? A. Running a half-marathon B. Biking up a mountain C. 50-meter free style swimming race D. Cross-country skiingChoose the best (of these options) human condition for measuring a proper basal metabolic rate. A. 15 minutes AFTER a light jog B. 15 minutes AFTER breakfast C. In the early morning BEFORE breakfast D. While swimming in a hot tub E. While sick with a cold
- If one were to infuse lactate into the blood stream during exercise via an I.V. catheter, which of the following physiological events would be observed? a. A significant increase in the burning sensation experienced in the lungs during rigorous exercise b. A decrease in exercise time to exhaustion (fatigue faster) c. An increase in liver gluconeogenic activity d. All of the above e. Only A and B are correcta. What are the advantages of the glucose peroxidase method of determining blood sugar? b. The principle of spectrophotometer is is based on _____ law. c. Differenciate hyperglycemia from hypoglycemia.Which of the following is a form of activity .9 characterized by movement and energy expenditure اختر أحد الخيارات a. Rest b. Endurance c. Stamina d. Exercise