Pyrosequencing uses what reactants?
Q: Please answer both of the following 1) The Haworth projection of D-altrose is shown What type of…
A: The cyclic structure of Glucose : The cyclic structure of furanose : The cyclic structure of…
Q: 1) Find the pH of 0.1 M of the differnet forms histidine species. (See image for equation and pKa…
A: Amino acids are building blocks of the proteins. Alpha carbon of amino acids consist of carboxyl…
Q: a) This molecule is produced when what amino acid is transaminated? b) What are the one- and…
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: How are GMOs applications of biotechnology?
A: Introduction:- The question is all about the genetic technology where genetic modification takes…
Q: Which of the following is arranged from least to most in terms of number of sugar units ?…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…
A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…
Q: Draw the two possible Haworth structures (both alpha and beta anomers) for the following…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 14. Consider the molecules below and the answer questions that follow. CH-0-8-R₁ HC-0-C-R₂ 0-4-0-0₂…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: a) It is known that double stranded DNA is denatured at low pH. pKa…
A: When a DNA solution is heated enough, the double-stranded DNA unwinds and the hydrogen bonds that…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: a) You evaluate the lipoxygenase inhibition by different concentrations of octyl protocathechuate.…
A: Inhibitors are the substances that bind to enzymes to regulate their activity . There are…
Q: A) what does the figure illustrate? B) Label the components in the figure pointed by the arrows and…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: An enzyme has a single active site at which it can bind and hydrolyze either X or Y; however, the…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: Name the primary sources of ATP for: a. Immediate energy for a few seconds b. Energy extending to…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP: the energy…
Q: I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946…
A: DNA is composed of sequence of nucleotides (adenine, thymine, guanine and cytosine) linked by 3-5…
Q: 2. Scheme of anaerobic oxidation of glucose and energy balance.
A: Organisms that live under anaerobic conditions rely only on glycolysis to generate ATP. Glycolysis…
Q: You are interested in cloning a gene that codes for an enzyme that produces a blue pigment. You have…
A: Introduction pUC19 is plasmid vector. Plasmid is a cloning vehicle used in recombinant DNA…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Experiment: Lipids Qualitative Tests Test Performed: Translucent Test Procedure 1. Fold your…
A: Lipids are a chemically diverse group of biomolecules with two common characteristics: low…
Q: What are the general properties of Lipids? 2. How do Lipids vary from other macromolecules? 3.…
A: Lipids are a diverse class of naturally occurring compounds. Fats, waxes, fat-soluble vitamins,…
Q: A plot of enzyme activity with and without an inhibitor present gave the following. Use two…
A: The rates of biochemical reactions are increased by proteins known as enzymes. Inhibitors are…
Q: The carbon skeletons of many amino acids can be used to replenish the intermediates of the citric…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Compare and contrast the following. Use you own words and be sure to incorporate key biochemical…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: An equilibrium dialysis study was carried out with a ligand binding receptor protein. The protein…
A: Scatchard plot is a very useful plot to determine the affinity of association of ligand and a…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Calculate and draw the isoelectric point of the tetrapeptide Ser-Leu-Phe-Pro at pH 7.0. hand written…
A: Isoelectric point is the pH at which the positive and negative charges are equal, i.e., the net…
Q: Which major biosynthetic pathways utilize PRPP? de novo purine synthesis lysine biosynthesis…
A: INTRODUCTION: De novo purine synthesis- it is the synthesis of complex molecules from simple…
Q: can you explain this again in a different way
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: What explains the side effect of "acetone-breath" on dieters following a low carbohydrate diet? O…
A: Ketone bodies refers to the following compounds: acetone, acetoacetate & β-hydroxybutyrate. They…
Q: Symport and antiport proteins must be active transport proteins A)True B)False
A: The biological membranes are selectively permeable. Transport across the biological membrane can be…
Q: You are running an ELISA to test three patients for COVID-19.The results of the test are shown below…
A: ELISA (enzyme-linked immunosorbent assay) is a enzyme linked analytical assay in which presence of…
Q: EXPLAIN your choices for each of the following: a) The Hb variant least likely to cause…
A: In general, the quaternary structure of any protein is determined by the amino acids present in that…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of…
A: Pyruvate kinase (PK): The role of pyruvate kinase is to catalyze the final phase of glycolysis,…
Q: a. What hormone is released in response to increased blood glucose? 2. b. The binding of this…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Question: 1. Will the…
A: DNA is the genetic material that is presented inside the nucleus of every cell. Banana is the best…
Q: QUESTION: Which of the following statements about Carbohydrates is TRUE? O The human body can…
A: Carbohydrates are one of the important biomolecules. These are also termed as hydrates of carbon.…
Q: Why do enzymes contain metals? What general reaction types to metalloenzymes catalyze?
A: Enzymes are biological catalysts proteinateous in nature that catalyze large number of biochemical…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…
A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…
Q: Explain why the combined presence of polyphenol oxidase and iron greatly increase the instability of…
A: Introduction Fatty acid is one of the macromolecule present in our body. Fats and oils are composed…
Q: purified protein sample was used in a reaction, resulting in an activity of 696.7 nmol min-1. The…
A: The activity of protein sample refers to the quantity of active protein present in the purified…
Q: *Complete hydrolysis of glycerophospholipid yields equimolar amounts of glycerol, a fatty acid [16:1…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Step by step
Solved in 2 steps
- a) What type of polymer is being formed in Reaction #3? b) Name an enzyme that can catalyze Reaction #3. c) What is △Go of Reaction #3? Show your work & clearly label your answer.Which set of conditions will give the product shown in this reaction? Br KOH, ethanol and heat water/acetone and heat tert-butoxide/tert-butyl alcohol tert-butyl alcohol and heat methoxide/methanolWhat is the purpose of using excess alcohol in a Fischer Esterification? 1) Using excess alcohol pushes the equilibrium reaction to the left, increasing the production of isopentyl acetate via Le Chatelier's principle. 2) Using excess alcohol pushes the equilibrium reaction to the right, decreasing the production of isopentyl acetate via Le Chatelier's principle. 3) Using excess alcohol pushes the equilibrium reaction to the left, decreasing the production of isopentyl acetate via Le Chatelier's principle. 4) Using excess alcohol pushes the equilibrium reaction to the right, increasing the production of isopentyl acetate via Le Chatelier's principle.
- What is the major organic product obtained from the following reaction? 3 1 4 2 CH22 Zn(Cu) Et20 H3C H3C 1 2 IH2Cwhich yields more free energy when completely oxidized, stearate or alpha-linolenate?Which of the following reagents can be used in the reaction in the photo? A.) pyridinium chlorochromate B.) potassium permanganate C.) sodium dichromate with sulfuric acid D.) potassium chromate with sulfuric acid
- Select the aldol condensation product of the following reaction. a A b B с C d D e E A H HO H NaOH, EtOH heat H H B D EReactants: Sodium Hydroxide (NaOH) Potassium Permanganate (KMnO4) Glucose (C12H22O11) What is the purpose of the sodium hydroxide in the redox reaction experiment?If you were reading a published journal article, where would you be most likely to find the following information? Match the following sections with the correct descriptions. The authors' proposed mechanism for the reaction studied. Information on work that had previously been published directly related to the current research. The specific amounts and moles of reagents used and the melting point obtained. Reaction conditions are also included. A summary of the results obtained with a graphic image. A scanned image of the actual HNMR spectrum. III = Abstract Introduction Experimental Section Supplemental Material Discussion
- Propose a reasonable synthetic route for the preparation of the substituted benzene derivative shown below. You may use whatever reagents are necessary to transform the starting molecule into the desired product. CH(CH3)2 step 1 step 2 step 3 čOH Step 1 reagent/reagents %3D Step 2 reagent/reagents %3D Step 3 reagent/reagentsGive a reaction equation for the qualitative and quantitative determination of I2.Which of the following is most correct about dehydration reactions? a)They often accompanied by hydrolysis of phosphate esters in biology b)They are easy to perform selectively in water c)Proteolysis is an example of a dehydration reaction