Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 5RQ
Summary Introduction
To review:
The method by which HIV provides ready-made components for replication of its genome and the formation of double-stranded DNA from single-stranded RNA through reverse transcription.
Introduction:
HIV (Human immunodeficiency virus) is a lentivirus which occurs in two different forms: HIV-1 and HIV-2. It gets transmitted via blood, genital or oral-genital contact. HIV hides within the host cells for several years and gradually initiates viral particles, most of which get eliminated by the host. It can destroy the thymic lymphocytes present in the body, leaving the host defenseless.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
To study the interaction between viral proteins and Z-DNA, how could Z-DNA-forming DNA be synthesized in the lab?
What are bypass polymerases? How do they differ fromthe replicative polymerases? How do their special features facilitate their role in DNA repair?
What is the end replication problem?
Chapter 11 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardWhat is Taq polymerase and why is it important?arrow_forwardWhat is the function of reverse transcriptase in retroviruses? a) It converts viral RNA into double-stranded DNA Ob) It uses viral RNA as a template for making complementary RNA strands Oc) It translates viral RNA into proteins d) It uses viral DNA as a template for RNA synthesisarrow_forward
- With respect to the replication strategy, what unusual feature does HBV have in common with HIV?arrow_forwardA cell is produced with a mutation that causes it produce a completely defective TFIIH. What does this likely mean for the fate of the cell? A) The cell's copied DNA may contain more errors. B) the cell cannot make RNA C) Producing RNAs will be slower because the polymerase will fall off the DNA more often. D) The cell cannot replicate its DNAarrow_forwardRNA-dependent RNA polymerase performs which of the following functions? O 1) Uncoats the viral genome 2) transcribes retroviral RNA genomes into DNA 3) Replicates RNA into RNA O 4) Replicates DNA into RNA 5) Shuttles RNA genomes into the nucleus for assemblyarrow_forward
- During the life cycle of the HIV virus, a transcription of DNA takes place, what are these used for transcript to?arrow_forwardWhich of the following is true of transposons? A) SINES are DNA-only transposons B) LINES are non-autonomous transposons Oa break induced repair is the mechanism by which this form of recombination C) occurs O D) recombinases form phosphotyrosine intermediates during transposition E) spo11 initiates the double-strand break to initiate transpostionarrow_forwardWhat does DNA polymerase need in order to make contact with a replication origin?arrow_forward
- What evolutionary advantage would a retrovirus gain by having the ability to regulate the sites of splicing of its RNA?arrow_forwardWhich of the following statements is false about DNA replication? A) Each lagging strand of DNA is started by an RNA primer. B) DNA polymerase joins nucleotides in the 5' to 3' direction only. C) The leading strand of DNA is made continuously. D) More than one replication fork is present. E) A replication bubble opens in one direction only.arrow_forwardWhich bacterial enzyme is responsible for removing the RNA primer of an Okazaki fragment and replacing it with DNA nucleotides during lagging strand replication?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY