![Study Guide for Campbell Biology](https://www.bartleby.com/isbn_cover_images/9780134443775/9780134443775_largeCoverImage.gif)
Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 22TYK
Summary Introduction
Introduction: Mutations refer to the alteration in the genome of an organism. Mutation is caused as a result of an error in the replication process of DNA. Mutations can be neutral, beneficial, or harmful for any organism. The alterations caused as a result of mutations is permanent in nature.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
A normal strand of DNA reads: 5'-AGTCAA-3'. If a mutation occurs that alters that DNA sequence to 5'-ACTCAA-3', that mutation could be characterized as a
O a. Base substitution
O b. Frameshift mutation
O c. Point mutation
O d. Both A&B
O e. Both A & C
Consider this sequence below:
GAG TAC ACG AGT GGA
Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!)
A. GAG TAC AAT CGA GTG GA
B. GAG TAC ACG GGT GGA
C. GAG TAC A–G AGT GGA
D. GAG TAC ACG AGA GGA
A small section of a gene for a protein has the following nucleotide sequence:
TAT AGG GAC CTA TGT
Which of the following mutations would cause a missense mutation in the sequence shown above?
a. Replacement of first cytosine base with guanine base
b. Replacement of final thymine base with guanine base
c. Replacement of second guanine base with cytosine base
d. Replacement of first thymine base with adenine base
Chapter 17 Solutions
Study Guide for Campbell Biology
Ch. 17 - a. In what three ways does RNA differ from DNA? b....Ch. 17 - Prob. 2IQCh. 17 - Prob. 3IQCh. 17 - How does the mRNA that leaves the nucleus differ...Ch. 17 - Prob. 5IQCh. 17 - In the following diagrams of polypeptide...Ch. 17 - What determines if a ribosome becomes bound to the...Ch. 17 - Define the following terms and explain what type...Ch. 17 - You have been introduced to several types of RNA...Ch. 17 - Prob. 2SYK
Ch. 17 - What is the genetic code? Explain redundancy and...Ch. 17 - Prepare a concept map showing the types and...Ch. 17 - Prob. 1TYKCh. 17 - Transcription involves the transfer of information...Ch. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - Which of the following is a statement of the...Ch. 17 - Prob. 6TYKCh. 17 - Prob. 7TYKCh. 17 - Prob. 8TYKCh. 17 - Which of the following is true of RNA processing?...Ch. 17 - Prob. 10TYKCh. 17 - Prob. 11TYKCh. 17 - Prob. 12TYKCh. 17 - Prob. 13TYKCh. 17 - Prob. 14TYKCh. 17 - What type of bonding is responsible for...Ch. 17 - Prob. 16TYKCh. 17 - Prob. 17TYKCh. 17 - Prob. 18TYKCh. 17 - Prob. 19TYKCh. 17 - Prob. 20TYKCh. 17 - Prob. 21TYKCh. 17 - Prob. 22TYKCh. 17 - Prob. 23TYKCh. 17 - Prob. 24TYKCh. 17 - Prob. 25TYKCh. 17 - Prob. 26TYKCh. 17 - Prob. 27TYKCh. 17 - Prob. 28TYK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA Mutated – CCU-GAU-GAG-UGA* Please choose one correct answer only A. Missense B. Nonsense C. Silent D. Frameshiftarrow_forwardWhat type of mutation is shown in the figure below? A. frameshift, insertion D. frameshift, deletion B. point mutation, silent C. base substitution, missense Normal hemoglobin DNA ст mRNA TT ALL Normal hemoglobin Glu Mutant hemoglobin DNA C I AT mRNA GU Sickle-cell hemoglobin Valarrow_forward-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTarrow_forward
- A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine basearrow_forwardUse the sequences below to determine what type of mutation has occurred by comparing the normal sequence to the mutated sequence. Normal Gene Sequence: 3'- ATAGCTAAGCCCATGCGG-5' Mutated Gene Sequence 3'-ATAGCTAAGCCCAGGTGCGG-5' A. Deletion - Point Mutation B. Insertion - Chromosomal Mutation C. Deletion - Frameshift Mutation D. Substitution - Point Mutation E. Insertion - Frameshift Mutation F. Insertion - Point Mutationarrow_forwardWhich of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. DA. GUACUGGCUAGCUGCUAGAA B. UUCUAGCAGCUAGCCAGUAC с. ТТСТАGCAGCTAGCCAGTАС D. GTACTGGCТAGCTGCTAGAАarrow_forward
- A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first guanine base with cytosine base b. Replacement of first thymine base with cytosine base c. Replacement of second thymine base with adenine base d. Replacement of seond guanine base with adenine basearrow_forwardA small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine basearrow_forwardDo you think each of the following types of mutationswould have very severe effects, mild effects, or no effectat all?a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the proteinb. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the proteinc. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein d. Frameshift mutations occurring in the sequencesencoding amino acids near the C terminus of theproteine. Silent mutationsf. Conservative missense mutationsg. Nonconservative missense mutations affecting theactive site of the proteinh. Nonconservative missense mutations not in the active site of the proteinarrow_forward
- 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUAarrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardNow the gene sequence was changed in a different way, such that instead of producing a mRNA with the codon UCG, it produced an mRNA with UAG. This change (UCG to UAG) is considered a O a. missense mutation O b. frame-shift mutation O c. silent mutation O d. nonsense mutationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY