a.
To explain: The meaning of saying that tRNA is a translator.
Introduction: The genetic information of DNA is based in the
b.
To fill: The given table using some of the codons and the amino acids.
Introduction: The genetic information of DNA is encrypted in the nucleotide base sequences. These sequences are transcribed into mRNA triplets and are called codons. These mRNA triplet nucleotides are then translated to form a polypeptide.
Want to see the full answer?
Check out a sample textbook solutionChapter 17 Solutions
Study Guide for Campbell Biology
- Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for letters a and b: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu a. Using the table of the genetic code, determine the sequence of amino acids. b. If mutation occurs by substitution of the 12th nucleotide with cytidine-5’-monophosphate, what is the resulting amino acid sequence? c. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forwardA. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?arrow_forwardA mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.arrow_forward
- Examine Table 15-2. The codon AUG codes for the amino acid methionine and also for “start.” What does “start” mean?arrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forwardGood hand written explanation Asap Briefly describe the 2-dimensional and 3-dimensional structure of tRNA . With diagram.arrow_forward
- If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA code? Recall that DNA does not use "U" as a base. Enter your answer below using the same format as shown here (three capital letters for each codon, separated by a single dash, no spaces, repeat for each codon). Table 26-1 The Genetic Code First Third Position Position (5'-end) Second Position (3'-end) U C A G Phe UAU UCU UCC Тyr Тyr Stop Stop UGU UGC Cys Cys Stop Trp UUU Ser U UUC Phe Ser UAC C UUA Leu UCA Ser UAA UGA A UUG Leu UCG Ser UAG UGG G Leu Leu Leu Leu CAU САС CAA CAG CUU CCU Pro Pro Pro Pro His His CGU Arg Arg Arg Arg U CỤC CỦA CUG CCC CCA CGC CGA C Gln Gln CCG CGG G Пе Thr ACU АСС ACA ACG AUU AAU Asn AGU Ser U AAC AAA AAG AUC Пе Thr Asn AGC Ser C AUA Ile Thr Lys Lys AGA AGG Arg Arg A A AUG* Met Thr GUU Val Val Val Val GCU GCC GCA GCG Ala GGU GGC GGA Gly Gly Gly Gly U C A GAU GỤC GUA GUG Asp Asp Glu Glu Ala GAC G Ala Ala GAA GAG GGG *AUG also serves as the principal initiation…arrow_forwardTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forwarda. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation in prokaryotes. b. If you have a given amino acid, can you be able to identify its RNA? Why or why not? c. How does mutation can affect the central dogma and the phenotype?arrow_forward
- Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Glutamic Acid-Glutamic Acid-COO- (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Valine-Glutamic Acid-COO- (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.arrow_forwardHow does initiation of translation occur in prokaryotes? Include a discussion of the ribosomal subunits, functional ribosome sites, mRNA, and tRNA in your answer.arrow_forwardShown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education