Principles of Biology
2nd Edition
ISBN: 9781259875120
Author: Robert Brooker, Eric P. Widmaier Dr., Linda Graham Dr. Ph.D., Peter Stiling Dr. Ph.D.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 19.2, Problem 3CC
Summary Introduction
To determine:
How many amino acid differences occur between the following pairs:
rhesus and green monkeys,
Congo puffer fish and European flounder,
rhesus monkey and
Congo puffer fish
Also, analyze the evolutionary relationship among these 4 species.
Introduction:
Evolutionary relationships can be understood on the basis of the gene sequences. Since the replication machinery in
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The total number of possible amino acid sequences in a polypeptide chain is staggering. Given that there are 20 amino acids, potentially there could be20100 different amino acid sequences just for polypeptides only 100 amino acids in length. However, the actual number of different polypeptides occurring in organisms is only a tiny fraction of this potential. What insight does this finding provide into the evolutionary process?
Suppose that the sequences of two proteins each consisting of 200 amino acids are aligned and that the percentage of identical residues has been calculated. How would you interpret each of the following results in regard to the possible divergence of the two proteins from a common ancestor? (a) 80% (b) 50% (c) 20% (d) 10%
A comparison of the aligned amino acid sequences of two proteins each consisting of 150 amino acids reveals them to be only 8% identical. However, their threedimensional structures are very similar. Are these two proteins related evolutionarily? Explain
Chapter 19 Solutions
Principles of Biology
Ch. 19.1 - Prob. 1TYKCh. 19.1 - Prob. 2TYKCh. 19.1 - The phrase an organism evolves is incorrect....Ch. 19.1 - Prob. 1BCCh. 19.2 - Explain how geography played a key role in the...Ch. 19.2 - Prob. 2CCCh. 19.2 - Prob. 3CCCh. 19.2 - Prob. 1TYKCh. 19.2 - Homologous traits show similarities because the...Ch. 19.3 - What is the frequency of pink flowers in a...
Ch. 19.3 - Prob. 1TYKCh. 19.3 - Prob. 2TYKCh. 19.4 - Lets suppose the climate on an island abruptly...Ch. 19.4 - Prob. 2CCCh. 19.4 - Prob. 3CCCh. 19.4 - Prob. 4CCCh. 19.4 - Prob. 1TYKCh. 19.4 - Prob. 2TYKCh. 19.4 - Prob. 3TYKCh. 19.5 - How does the bottleneck effect undermine the...Ch. 19.5 - Prob. 1TYKCh. 19.5 - Prob. 2TYKCh. 19.5 - Prob. 1BCCh. 19.6 - How does migration affect the genetic compositions...Ch. 19.6 - Prob. 1BCCh. 19.6 - Prob. 1TYKCh. 19.6 - Populations that experience inbreeding may also...Ch. 19 - Prob. 1TYCh. 19 - An evolutionary change in which a population of...Ch. 19 - Homology occurs because different species occupy...Ch. 19 - Prob. 4TYCh. 19 - Prob. 5TYCh. 19 - Prob. 6TYCh. 19 - Prob. 7TYCh. 19 - Prob. 8TYCh. 19 - Prob. 9TYCh. 19 - The micro-evolutionary factor most sensitive to...Ch. 19 - Prob. 1CCQCh. 19 - Prob. 2CCQCh. 19 - A principle of biology is that populations of...Ch. 19 - Prob. 1CBQCh. 19 - Prob. 2CBQ
Knowledge Booster
Similar questions
- When comparing the α-globin protein in cow and humans, you find that they differ at 20 of the 165 amino acid sites in the alignment. What is the proportion of substitutions that have occurred since humans and cows diverged from each other?arrow_forwardIf a sequence from another species showed a 96 percent sequence similarity to humans, would that species be more or less closely related to humans than chimpanzees are?arrow_forwardName two enzymes/protein complexes in molecular biology that contain both RNA and protein. What processes are they involved in?arrow_forward
- Proteins called molecular chaperones assist in the process of protein folding. One class of chaperones found in organisms from bacteria to mammals is heat shock protein 90 (Hsp90). All Hsp90 chaperones contain a 10 amino acid “signature sequence” that allows ready identification of these proteins in sequence databases. Two representations of this signature sequence are shown below. (a) In this sequence, which amino acid residues are invariant (conserved across all species)?(b) At which position(s) are amino acids limited to those with positively charged side chains? For each position, which amino acid is more commonly found?(c) At which positions are substitutions restricted to amino acids with negatively charged side chains? For each position, which amino acid predominates?(d) There is one position that can be any amino acid, although one amino acid appears much more often than any other. What position is this, and which amino acid appears most often?arrow_forwardAs determined by comparisons of ancient and recently evolved proteins, cysteine, tyrosine, and phenylalanine appear to be late-arriving amino acids. In addition, they are considered to have been absent in the abiotic Earth. All three of these amino acids have only two codons each, while many others, earlier in origin, have more. Is this mere coincidence, or might there be some underlying explanation?arrow_forwardHow many comparisons are needed to count the number of duplicates in a list? How many comparisons are needed to find the maximum value in a list of numbers? How many unique length 3 codons coding amino acids can be made from the unique 4 nucleotides found in genes?arrow_forward
- According to molecular sequence data, to which prokaryotic group are eukaryotes more closely related?arrow_forwardMolecular Biology Cytochrome c is a protein found in mitochondria. It is used in the study of evolutionary relationships because most animals have this protein. Cytochrome c is made of 104 amino acids joined together. Below is a list of the amino acids in part of a cytochrome protein molecule for 9 different animals. Any sequences exactly the same for all animals have been skipped. For each non-human animal, take a highlighter and mark any amino acids that are different than the human sequence. When you finish, record how many differences you found in the table on the next page. 42 43 44 46 47 49 50 53 54 55 56 57 Human A Y S T. А K N G Chicken Q A E S T. K K G Horse A P D K N K G Tuna Q E F Frog A А S D K N K G Shark A Q T. D K S K Turtle Q A E F K N K G Monkey Q А Y T. K Rabbit Q А V F D K N K G 58 60 61 62 63 64 65 66 100 101 102 103 104 Human G E D M E K A T N E Chicken G E D M D A Horse T K E E T L M E K A T N E Tuna V E T L R E K Frog T. G E T L M E S A K Shark Q E L R K A A…arrow_forwardMolecular Biology Cytochrome c is a protein found in mitochondria. It is used in the study of evolutionary relationships because most animals have this protein. Cytochrome c is made of 104 amino acids joined together. Below is a list of the amino acids in part of a cytochrome protein molecule for 9 different animals. Any sequences exactly the same for all animals have been skipped. For each non-human animal, take a highlighter and mark any amino acids that are different than the human sequence. When you finish, record how many differences you found in the table on the next page. 42 43 44 46 47 49 50 53 54 55 56 57 Human Q A P Y S A K K Chicken A E F D K N K Horse Tuna Q A A F K K K K Q Frog A A F S D K N K G Shark A Q F T. D K K G Turtle A E F S E K N. K G Monkey A P Y А K K G Rabbit Q A V F S T. K N K G 58 60 61 62 63 64 65 66 100 101 102 103 104 Human G E D L M K A N E Chicken G E T. M E D A K Horse Tuna K N E E M A N IN K Frog G E E T. L M E S A S K Shark E R K A A S Turtle G E E T.…arrow_forward
- With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…arrow_forwardBeadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In subsequent years, many exceptions to this hypothesis were noted. A molecule of hemoglobin fails to support this hypothesis for which of the following reasons? n eukaryotes, one gene can code form multiple isoforms of a polypeptide. The functional hemoglobin protein is made from multiple polypeptides. Not all enzymes are proteins. Not all genes encode proteins.arrow_forwardWhy is the One-Gene-One Protein Hypothesis now replaced by the One-Gene-One-Polypeptide Hypothesis?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning